API Documentation — VigyanLLM Developer

Authentication

All API requests require a Bearer token in the Authorization header:

Authorization: Bearer vly_sk_your_api_key_here

Generate keys from the API Keys page. Keys are scoped to specific endpoints and have configurable rate limits.

Rate Limits

Rate limits are per API key and vary by plan:

Plan	Calls / Month	Rate Limit
Free	No API access	—
Pro (₹699/mo)	1,000	30 req/min
Lab (₹1,999/mo)	10,000	120 req/min

Rate limit headers are returned with every response: X-RateLimit-Limit, X-RateLimit-Remaining, X-RateLimit-Reset.

Endpoints

▶ POST /api/v1/primer/design Design and validate PCR primers

Request Body (JSON):

{
  "sequence": "ATGCGATCGATCG...",     // Required: DNA sequence (≥100 bp)
  "organism": "human",                  // Optional: human, mouse, rat, etc.
  "amplicon_min": 70,                   // Optional: min amplicon size (default 70)
  "amplicon_max": 200,                  // Optional: max amplicon size (default 200)
  "tm_min": 58,                         // Optional: min Tm (default 58)
  "tm_max": 65                          // Optional: max Tm (default 65)
}

Response (200):

{
  "status": "success",
  "pairs": [
    {
      "forward": "GACCCCAAAATCAGCGAAAT",
      "reverse": "TCTGGTTACTGCCAGTTGAATCTG",
      "tm_fwd": 59.8,
      "tm_rev": 60.1,
      "gc_pct": 52.3,
      "amplicon_size": 142,
      "hairpin_dg": -1.2,
      "self_dimer_dg": -3.4,
      "cross_dimer_dg": -2.8,
      "blast_specificity": "PASS",
      "snp_risk": "LOW"
    }
  ],
  "job_id": "a1b2c3d4"
}

▶ POST /api/v1/blast/search Run BLAST search against nr/nt database

Request Body (JSON):

{
  "query": "GACCCCAAAATCAGCGAAAT",      // Required: DNA/protein sequence
  "database": "nr",                      // Optional: nr, nt, refseq_rna
  "program": "blastn",                   // Optional: blastn, blastp, blastx
  "evalue": 0.001                        // Optional: E-value threshold
}

Response (200):

{
  "status": "success",
  "hits": [
    {
      "accession": "NM_007294.4",
      "description": "BRCA1 DNA repair associated",
      "score": 142,
      "evalue": 2.1e-42,
      "identity": 100,
      "query_coverage": 100
    }
  ],
  "job_id": "e5f6g7h8"
}

▶ POST /api/v1/msa/align Multiple sequence alignment (Clustal Omega)

Request Body (JSON):

{
  "sequences": [                         // Required: 2–50 sequences
    ">seq1\nATGCGATCGATCG",
    ">seq2\nATGCAATCGATCG"
  ],
  "format": "clustal"                    // Optional: clustal, fasta, json
}

Response (200):

{
  "status": "success",
  "alignment": ">seq1\nATGCGATCGATCG\n>seq2\nATGCAATCGATCG",
  "stats": {
    "sequences": 2,
    "length": 16,
    "identity_pct": 93.75,
    "gap_pct": 0
  },
  "job_id": "i9j0k1l2"
}

Error Codes

Code	Meaning	Action
400	Bad Request — missing or invalid parameters	Check request body against endpoint schema
401	Unauthorized — missing or invalid API key	Verify your API key is valid and included in the header
403	Forbidden — key lacks scope for this endpoint	Generate a new key with the required scope
404	Not Found — invalid endpoint URL	Check the endpoint path in the docs
429	Too Many Requests — rate limit exceeded	Wait for the reset window or upgrade your plan
500	Internal Server Error	Retry with exponential backoff; contact support if persistent

Webhook Events

Subscribe to events via the Webhooks page. All payloads are JSON-encoded and signed with your webhook secret.

Event	Description	Trigger
`primer.complete`	Primer design job finished	POST /api/v1/primer/design async completion
`blast.complete`	BLAST search finished	POST /api/v1/blast/search async completion
`payment.captured`	Payment successfully captured	Razorpay webhook → plan activation
`user.created`	New user account created	Registration or first Google sign-in