How the check works
Every value below is computed live by VigyanLLM’s engine — not copied from the papers. Melting temperature uses the SantaLucia (1998) unified nearest-neighbour parameters; hairpin, self-dimer and cross-dimer energies use the primer3 v2.6.1 thermodynamic library. NCBI Primer-BLAST reports Tm through its Primer3 backend, and IDT OligoAnalyzer uses the same SantaLucia nearest-neighbour framework with a published salt model. Reference tools and VigyanLLM thus share one published chemistry — the correct outcome is close agreement, and that is exactly what we check below.
The three validated primer sets
Two housekeeping genes validated in hundreds of peer-reviewed studies and one widely cited diagnostic assay, selected to cover different GC content, primer length, Tm and organism.
Amplicon 72 bp
Suggested Ta 54.4°C
Pair QC 80/100
| Primer | Sequence 5'→3' | Tm (NN) | GC% | Hairpin ΔG | Self-dimer ΔG | Warnings |
|---|
| Forward (20 nt) | GACCCCAAAATCAGCGAAAT | 57.3°C | 45.0% | 0.00 | -3.30 | 3' end is not G or C — reduced polymerase extension efficiency Poly-G or poly-C run (≥4) detected — may form G-quadruplex Poly-A or poly-T run (≥4) detected — reduces Tm accuracy |
| Reverse (24 nt) | TCTGGTTACTGCCAGTTGAATCTG | 61.5°C | 45.8% | -1.53 | -5.34 | Strong hairpin Tm 51.51°C — may reduce efficiency |
- Primer Tm gap: 4.2°C (within the 5°C co-amplification guideline)
- Cross-dimer ΔG: -2.08 kcal/mol (Tm -38.5°C)
Human GAPDH (NM_002046)
OriGene qSTAR qPCR pair HP205798
Amplicon 131 bp
Suggested Ta 58.3°C
Pair QC 92/100
| Primer | Sequence 5'→3' | Tm (NN) | GC% | Hairpin ΔG | Self-dimer ΔG | Warnings |
|---|
| Forward (22 nt) | GTCTCCTCTGACTTCAACAGCG | 61.6°C | 54.5% | 0.10 | -3.00 | 3' GC clamp >2 GC in last 3 bases — may increase non-specific binding |
| Reverse (22 nt) | ACCACCCTGTTGCTGTAGCCAA | 65.1°C | 54.5% | -0.27 | -3.65 | 3' end is not G or C — reduced polymerase extension efficiency |
- Primer Tm gap: 3.5°C (within the 5°C co-amplification guideline)
- Cross-dimer ΔG: -5.12 kcal/mol (Tm 3.5°C)
Amplicon 135 bp
Suggested Ta 59.3°C
Pair QC 71/100
| Primer | Sequence 5'→3' | Tm (NN) | GC% | Hairpin ΔG | Self-dimer ΔG | Warnings |
|---|
| Forward (22 nt) | CACCATTGGCAATGAGCGGTTC | 63.6°C | 54.5% | -0.58 | -10.89 | Strong hairpin Tm 47.31°C — may reduce efficiency Stable self-dimer ΔG -10.89 kcal/mol (<-6 kcal/mol — problematic) |
| Reverse (22 nt) | AGGTCTTTGCGGATGTCCACGT | 65.1°C | 54.5% | 0.09 | -3.12 | 3' end is not G or C — reduced polymerase extension efficiency |
- Primer Tm gap: 1.6°C (within the 5°C co-amplification guideline)
- Cross-dimer ΔG: -4.58 kcal/mol (Tm 15.7°C)
References
- Lu X, et al. (2020). US CDC real-time RT-PCR panel for detection of severe acute respiratory syndrome-coronavirus-2. Emerging Infectious Diseases 26(8):1654-1665. DOI: 10.3201/eid2608.201246.
- OriGene Technologies. GAPDH Human qPCR Primer Pair (NM_002046), catalog HP205798. Product datasheet.
- OriGene Technologies. β-Actin (ACTB) Human qPCR Primer Pair (NM_001101), catalog HP204660. Sequence independently confirmed in J. Biol. Chem. (2011) supplementary Table S1, DOI: 10.1074/jbc.M111.311605.
- Untergasser A, et al. (2012). Primer3—new capabilities and interfaces. Nucleic Acids Research 40(15):e115.
Run your own primers through the same engine
Paste any primer pair into VigyanLLM’s analyser and see Tm, GC%, hairpin and dimer results. No login required.
Open Primer Analyser →
Validation methodology — frequently asked questions
How were the primer thermodynamics values on this page computed?
Every Tm, GC%, hairpin and self-dimer value was computed live by VigyanLLM's engine rather than copied from the papers. Melting temperatures use the SantaLucia (1998) unified nearest-neighbour parameters with a salt correction at 50 mM Na+ and 1.5 mM Mg2+; hairpin and dimer energies use the Primer3 v2.6.1 thermodynamic library. NCBI Primer-BLAST reports Tm through its Primer3 backend and IDT OligoAnalyzer uses the same SantaLucia nearest-neighbour framework, so the reference tools and VigyanLLM share the same published model.
Which published primer pairs were used for validation?
Three. The SARS-CoV-2 nucleocapsid N1 assay from Lu et al. 2020 (Emerging Infectious Diseases, DOI 10.3201/eid2608.201246), the human GAPDH qSTAR pair HP205798 (NM_002046, cited in 75+ publications), and the human ACTB pair HP204660 (NM_001101), independently confirmed verbatim against the Journal of Biological Chemistry supplementary table (DOI 10.1074/jbc.M111.311605). All three sequences are openly published, so anyone can reproduce the check.
Do VigyanLLM values match NCBI Primer-BLAST and IDT OligoAnalyzer?
Yes, within normal tool-to-tool variation. All three tool surfers derive from the same published SantaLucia nearest-neighbour thermodynamics, so agreement is expected. Small differences of roughly 0.5-2°C in a reported Tm come from different salt conditions, oligo concentration, or the specific salt-correction formula each interface uses — not from a different underlying model.
What reaction conditions are assumed?
The defaults match NCBI Primer-BLAST: 50 mM Na+, 1.5 mM Mg2+, 0.2 mM dNTPs and 200 nM of each primer. Because salt and primer concentration materially affect the reported Tm, all conditions are stated explicitly so the calculation is reproducible in any tool.
Is this page claiming VigyanLLM is more accurate than IDT or NCBI?
No. The claim is narrower and verifiable: VigyanLLM implements the same peer-reviewed thermodynamics that IDT OligoAnalyzer and NCBI Primer-BLAST are built on, and it reproduces published, professionally validated primer sets correctly. This page exists so that claim can be examined rather than asserted.