What is BLAST?

BLAST stands for Basic Local Alignment Search Tool. It is the single most important algorithm in bioinformatics — published by Altschul et al. in 1990 and cited over 100,000 times. BLAST takes a query sequence (DNA or protein) and compares it against a database of known sequences, finding regions of local similarity that share biological meaning.

When you run BLAST, the tool breaks your query into short fragments called words (or k-mers), searches the database for exact matches to those words, and then extends the matches in both directions to build alignment segments. Each hit receives a statistical score — the E-value — that tells you how likely the match is to have occurred by chance. A lower E-value means a more significant hit.

BLAST is used daily by molecular biologists, clinical researchers, and bioinformaticians for tasks ranging from identifying an unknown PCR product to predicting the function of a newly sequenced protein. If you have a sequence and want to know what it is, where it comes from, or what it does, BLAST is the first tool you reach for.

Why BLAST Matters

Before BLAST, identifying an unknown sequence required days of manual literature searching. Today, a 10-second BLAST search can tell you that your 200 bp amplicon matches human GAPDH (NM_002046) at 100% identity with an E-value of 0.0 — meaning the match is as close to certain as statistics allow.

How to Run BLAST Free Online

You can run BLAST in your browser without installing software or creating an account. Here is the step-by-step process:

Step 1: Open the Free BLAST Tool

Navigate to VigyanLLM BLAST in any modern browser. No NCBI account is needed and there are no server queue wait times.

Step 2: Paste Your Query Sequence

Paste your nucleotide or protein sequence into the input box. You can use FASTA format (with a > header line) or paste a raw sequence without any formatting. BLAST handles both.

For nucleotide queries, the tool defaults to blastn (nucleotide-vs-nucleotide). For protein queries, it uses blastp. You can change the program in the settings.

Step 3: Select the Database

Choose the database that matches your search goal:

  • nt — All non-redundant nucleotide sequences (GenBank + RefSeq + others). Best for general DNA searches.
  • nr — Non-redundant protein sequences. Best for protein function searches.
  • refseq_rna — Curated RefSeq transcripts. Best for gene-level nucleotide searches.
  • Organism-specific genomes — Search a single genome for specificity verification.

Step 4: Run the Search

Click Run BLAST. Results appear in seconds. You will see a ranked table of hits, each with an E-value, percent identity, query coverage, and alignment score. Below the table, pairwise alignments show exactly where your query matches each hit.

Step 5: Interpret the Results

Focus on the top hits with the lowest E-values. An E-value of 0.0 means the match is essentially perfect — the probability of seeing this alignment by chance is zero. Check percent identity (how similar the sequences are) and query coverage (what fraction of your query aligns). We cover interpretation in detail in the E-value section below.

Worked Example: Searching Human GAPDH

We ran BLAST with the human GAPDH forward primer sequence GTCTCCTCTGACTTCAACAGCG against the nt database using blastn.

Top hit: Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA (NM_002046.7) — E-value: 0.0, Identity: 100%, Coverage: 100%. The query matches positions 131–152 of the GAPDH transcript with zero mismatches. This confirms the primer targets exactly where it should.

BLAST Types: blastn vs blastp vs blastx

BLAST comes in several flavours, each designed for a specific type of sequence comparison. Choosing the wrong BLAST program produces misleading results — a protein query run through blastn will miss homologs that diverged at the DNA level but conserved their amino acid sequence.

Program Query Database Best For Sensitivity
blastn Nucleotide Nucleotide DNA identity, primer verification, gene finding Fast, less sensitive for distant homologs
blastp Protein Protein Protein function, domain detection, evolutionary analysis Most sensitive for functional homology
blastx Nucleotide (translated) Protein Identifying coding regions in DNA, finding protein homologs from nucleotide queries High — translates in all 6 frames
tblastn Protein Nucleotide (translated) Searching protein against a genome where protein database is unavailable High — translates database in 6 frames
tblastx Nucleotide (translated) Nucleotide (translated) Comparing two nucleotide sequences at the protein level Highest — translates both sides; slowest

When to Use blastn

Use blastn when your query is a DNA sequence and you want to find the closest nucleotide match. This is the right choice for primer specificity checking, identifying a PCR product, or verifying a synthetic oligonucleotide. blastn is the fastest BLAST program because it does not perform any translation.

When to Use blastp

Use blastp when your query is a protein sequence. Protein sequences are more conserved across evolution than DNA — two proteins can share 70% amino acid identity while their encoding genes have only 50% nucleotide identity due to codon degeneracy. blastp is more sensitive for detecting distant evolutionary relationships.

When to Use blastx

Use blastx when you have a nucleotide sequence but want to find protein homologs. The tool translates your query in all six reading frames and searches a protein database. This is invaluable for identifying coding regions in uncharacterised DNA or finding conserved protein domains in a newly assembled contig.

Run BLAST Free — No Signup Required

Paste any nucleotide or protein sequence. Get instant results with E-values, identity scores, and pairwise alignments. Supports blastn, blastp, blastx, tblastn, and tblastx.

Open VigyanLLM BLAST →

VigyanLLM BLAST vs NCBI BLAST

NCBI BLAST (blast.ncbi.nlm.nih.gov) is the original implementation and remains the most widely used. VigyanLLM provides a free alternative that addresses specific pain points researchers face with the NCBI version.

Feature VigyanLLM BLAST NCBI BLAST
Price Free Free
Signup Required No Optional (required for saved searches)
Server Queue None — instant results 15–60 second wait during peak hours
BLAST Programs blastn, blastp, blastx, tblastn, tblastx All standard programs
Databases nt, nr, refseq, organism-specific Full NCBI database collection
Integration with Other Tools Links to Primer Design, MSA, Tm Calculator Standalone
Result Format Ranked table + pairwise alignments + export Ranked table + pairwise alignments
Batch Search Yes Yes (with account)

When to use NCBI BLAST: If you need access to the full NCBI database collection, want to use BLAST IDs for programmatic access, or are working within the NCBI ecosystem (RefSeq, GenBank, PubChem), NCBI BLAST is the canonical choice. It is also the right tool when you need the Web BLAST API for automated pipelines.

When to use VigyanLLM BLAST: If you want fast, instant results without server queues or account creation, and you also want to link your BLAST results directly into downstream tools like primer design or multiple sequence alignment, VigyanLLM is the more convenient option. The integrated workflow means you can BLAST a sequence, identify the gene, design primers for it, and align homologs — all without leaving the browser.

Interpreting BLAST Results — E-value, Identity, Coverage

BLAST results can look overwhelming if you have never seen them before. Every result table has the same core columns. Here is what each one means and how to use them to judge whether a hit is real.

E-value (Expect Value)

The E-value is the most important column. It tells you how many hits of this quality you would expect to find by chance in a database of this size. An E-value of 0.0 means the match is so good that the probability of it occurring randomly is effectively zero. Here is a practical guide:

  • E-value = 0.0 — Perfect or near-perfect match. This is your target sequence or a very close relative.
  • E-value < 1e-50 — Extremely significant. Almost certainly a true homolog.
  • E-value 1e-10 to 1e-50 — Highly significant. Likely a homolog worth investigating.
  • E-value 1e-3 to 1e-10 — Possibly significant. Check identity and coverage carefully; this could be a distant homolog or a conserved domain.
  • E-value > 1 — Not significant. This match is probably noise.

Percent Identity

Percent identity tells you what fraction of the aligned residues are identical between your query and the subject. A 100% identity hit means every residue in the alignment matches exactly. For species-level identification, you typically want identity above 95%. For cross-species homology, identity can be much lower (30–70%) and still be biologically meaningful.

Query Coverage

Query coverage tells you what percentage of your query sequence is included in the alignment. A hit with 100% coverage and 98% identity is more reliable than a hit with 30% coverage and 100% identity — the low-coverage hit may only match a conserved domain rather than the full gene.

Alignment Score (Bit Score)

The bit score is a normalised measure of the alignment quality. Higher scores mean better alignments. Unlike raw scores, bit scores are comparable across different database searches because they account for database size and composition. Use bit scores to compare hits within the same BLAST run, not across different runs.

Red Flags in BLAST Results

High identity, low coverage: The query matches a small region of the subject — likely a conserved domain, not a true ortholog.
Low identity, high coverage: The entire query aligns but with many mismatches — possibly a distant homolog or a coincidental match in a different gene family.
Multiple hits with similar E-values: Your query may match several genes — check whether you need to redesign for specificity.

Common BLAST Mistakes

Even experienced researchers make BLAST errors that lead to wrong conclusions. Here are the five most common mistakes and how to avoid them.

1. Using the wrong BLAST program. Running a protein sequence through blastn will produce hits to the coding DNA, but you will miss protein-level homologs where the DNA has diverged but the amino acid sequence is conserved. If your query is a protein, always use blastp.

2. Ignoring E-values above 1e-3. A hit with E-value 0.01 looks statistically significant until you realise that in a database of millions of sequences, you expect several such hits by chance. Always check whether the identity and coverage support the E-value — do not trust E-values alone.

3. Searching the wrong database. Searching nt for a protein sequence wastes time and produces confusing results. Searching nr for a short primer oligonucleotide returns thousands of unrelated hits. Match your query type to the right database: nucleotides in nt or refseq, proteins in nr.

4. Not checking query coverage. A 100% identity hit covering only 20% of your query is not a full-length match. It could be a conserved motif shared across many genes. Always prefer hits with coverage above 80% for gene identification.

5. Forgetting to verify primer specificity. If you designed a primer and want to confirm it targets the right gene, BLAST the primer against the genome of your target organism. A primer that matches two genomic locations will produce multiple bands in PCR. Use VigyanLLM Primer Design to check specificity automatically alongside thermodynamic validation.

BLAST Your Sequence Now

Run blastn, blastp, or blastx on any sequence. No NCBI account. No server queue. Instant results with E-values, identity, and pairwise alignments.

Run Free BLAST Search →

Frequently Asked Questions

What is BLAST used for?

BLAST (Basic Local Alignment Search Tool) is used to compare a DNA or protein query sequence against a database of known sequences to find regions of similarity. It is the most widely used bioinformatics tool for sequence homology searching — identifying genes, predicting protein function, verifying primer specificity, finding conserved domains, and detecting evolutionary relationships. Researchers use BLAST daily to answer questions like "What gene does this sequence belong to?" or "Are there similar sequences in other organisms?"

Is there a free BLAST tool online?

Yes, there are several free BLAST tools available online. NCBI provides the original BLAST service at blast.ncbi.nlm.nih.gov, though it can experience wait times during peak usage. VigyanLLM offers a free browser-based BLAST tool that provides instant results with no signup required. It supports all major BLAST variants (blastn, blastp, blastx, tblastn, tblastx) and lets you choose from multiple databases including nt, nr, refseq, and organism-specific genomes.

What is the difference between blastn and blastp?

blastn compares a nucleotide query against a nucleotide database, while blastp compares a protein query against a protein database. blastn uses scoring matrices optimised for DNA (match/mismatch scores), while blastp uses substitution matrices like BLOSUM62 for amino acid similarity. blastp is generally more sensitive because protein sequences are more conserved across evolution — a protein sequence can diverge significantly at the DNA level while retaining the same function. Choose blastn for DNA identity searches and blastp for functional homology detection.

How do I interpret BLAST E-values?

The E-value (expect value) represents the number of hits you would expect to see by chance in a database of a given size. A lower E-value means a more significant match. As a rule of thumb: E-value less than 1e-50 indicates a very close homolog, 1e-10 to 1e-50 suggests a probable homolog, 1e-3 to 1e-10 indicates a possible distant homolog requiring manual inspection, and E-value greater than 1 is likely noise. Always consider E-value alongside percent identity and query coverage — a high-identity hit with poor coverage may indicate a partial match or conserved domain rather than a true homolog.

Can I use BLAST without NCBI?

Yes. While NCBI maintains the original BLAST implementation, several alternatives exist. VigyanLLM provides a free browser-based BLAST tool that runs without an NCBI account and delivers results without server queue wait times. You can also install BLAST locally using NCBI's command-line BLAST+ package, which gives you full control over databases and parameters. For most users who want fast, free, browser-based BLAST access without creating any account, online alternatives like VigyanLLM are the most convenient option.

BLAST is not just a database search tool — it is the foundation of modern molecular biology workflows. A correctly run BLAST search tells you what your sequence is, where it came from, and what it might do. A incorrectly run BLAST search gives you false confidence in a wrong answer. Choose the right program, check E-values against identity and coverage, and always verify critical results with a second search using a different database or BLAST variant.

For researchers working at the bench, BLAST integrates naturally with downstream tools. After identifying a gene with BLAST, you can design primers using VigyanLLM Primer Design, align homologous sequences with Multiple Sequence Alignment, and verify your results with the validation benchmark. The fastest sequence analysis workflow is one where every tool talks to the next — and that starts with BLAST.

References

  1. Altschul S.F., et al. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403-410.
  2. Altschul S.F., et al. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25(17), 3389-3402.
  3. Ye J., et al. (2012). Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics, 13, 134.
  4. Camacho C., et al. (2009). BLAST+: architecture and applications. BMC Bioinformatics, 10, 421.