Why BLAST Interpretation Matters
A BLAST search produces a table of hits ranked by statistical significance. But the table itself does not tell you which hits matter. A hit with E-value 0.0 and 100% identity is almost certainly your target. A hit with E-value 0.001 and 95% identity might be a close homolog — or a misleading match in the wrong gene. The difference between a correct and incorrect BLAST interpretation is the difference between publishing a real finding and wasting months chasing a false lead.
Every BLAST result has four core metrics: E-value, percent identity, query coverage, and bit score. Understanding what each one means — and, critically, how they interact — is the most important skill in sequence analysis.
E-value Explained
The E-value (expect value) is the single most important column in a BLAST result. It tells you how many hits of this quality or better you would expect to find by chance in a database of this size. A lower E-value means a more significant hit.
Here is a practical guide to interpreting E-values:
- E-value = 0.0 — Perfect or near-perfect match. The probability of this match occurring by chance is effectively zero. This is your target sequence or a very close relative.
- E-value < 1e-100 — Extremely significant. Almost certainly a true homolog. Safe to assume biological relevance.
- E-value 1e-50 to 1e-100 — Highly significant. Very likely a true homolog. Investigate further if the identity is below 95%.
- E-value 1e-10 to 1e-50 — Significant. Likely a homolog worth investigating. Check identity and coverage carefully.
- E-value 1e-3 to 1e-10 — Possibly significant. This could be a distant homolog or a conserved domain. Manual inspection is required.
- E-value > 1 — Not significant. This match is probably noise. Do not trust it without additional evidence.
A common mistake is treating the E-value like a p-value and applying a significance threshold like 0.05. BLAST E-values work differently — they are scaled to the database size. An E-value of 0.001 in a small database (1,000 sequences) means something different than 0.001 in the nr database (hundreds of millions of sequences). Always interpret E-values relative to the database you searched.
Percent Identity vs Similarity
Percent identity is the fraction of aligned residues that are identical between your query and the subject. If your 100 bp query aligns to a subject with 95 identical bases and 5 mismatches, the percent identity is 95%.
Percent similarity (also called percent positive) includes both identical matches and conservative substitutions — amino acid changes that preserve biochemical properties (e.g., leucine to isoleucine). Percent similarity is always equal to or higher than percent identity.
| Metric | What It Measures | When to Use | Typical Threshold |
|---|---|---|---|
| Percent Identity | Exact matches only | Species identification, primer verification | >95% for species, >97% for strain |
| Percent Similarity | Exact + conservative substitutions | Functional homology, distant evolution | >30% for protein homologs |
For most researchers, percent identity is the metric to focus on. Use percent similarity only when you are specifically looking for conserved protein function where conservative substitutions matter.
Query Coverage
Query coverage tells you what percentage of your query sequence is included in the alignment. A 100% coverage hit means your entire query aligns to the subject. A 20% coverage hit means only one-fifth of your query matches.
Coverage matters because a short alignment in a conserved region can produce a misleadingly low E-value. Consider these two scenarios:
- Hit A: 98% identity, 100% coverage — This is a full-length match. The subject is likely the same gene or a very close ortholog.
- Hit B: 100% identity, 8% coverage — This matches only a small conserved motif. The subject could be a completely different gene that shares one short domain.
Hit A is more biologically meaningful than Hit B, even though Hit B has higher identity. Always check coverage alongside identity.
Alignment Score (Bit Score)
The bit score is a normalised measure of the alignment quality. Higher scores mean better alignments. Bit scores account for the scoring matrix used, the gap penalties, and the database composition, making them comparable across different BLAST runs against the same database.
Unlike raw scores, bit scores are normalised to a standard scale. A bit score of 200 means something different than a bit score of 50. In practice, bit scores are most useful for comparing hits within the same BLAST result — the hit with the highest bit score is generally the best alignment.
Worked Example with Real Results
We ran the human beta-actin (ACTB) forward primer CACCATTGGCAATGAGCGGTTC against the nt database using blastn.
Hit 1: Homo sapiens ACTB mRNA (NM_001101.5) — E-value: 2e-09, Identity: 100%, Coverage: 100%, Bit score: 42.8. The query matches positions 155–176 of the ACTB transcript with zero mismatches. This confirms the primer targets ACTB correctly.
Hit 2: Pan troglodytes ACTB mRNA (XM_025123046.2) — E-value: 8e-09, Identity: 95%, Coverage: 100%, Bit score: 40.1. The query matches the chimpanzee ACTB ortholog with 1 mismatch. This is expected — chimp and human ACTB are highly conserved.
Hit 3: Mus musculus Actb mRNA (NM_007393.4) — E-value: 3e-07, Identity: 86%, Coverage: 100%, Bit score: 36.2. The query matches the mouse ortholog with 3 mismatches. This is still significant — ACTB is conserved across mammals.
Hit 4: Synthetic construct — E-value: 0.52, Identity: 82%, Coverage: 45%, Bit score: 18.4. This is a partial match to a synthetic sequence. The E-value above 1 and low coverage mean this hit is not significant.
Interpretation: Hits 1-3 are real ACTB homologs (low E-values, high coverage, decreasing identity across species). Hit 4 is noise (E-value > 1, low coverage).
Red Flags to Watch For
1. High identity, low coverage. A 100% identity hit covering only 10% of your query is likely matching a conserved motif, not a true full-length homolog. This is common when searching short queries against large databases — the E-value looks good because of the high identity, but the alignment is too short to be meaningful.
2. Low identity, high coverage. The entire query aligns but with many mismatches. This could be a distant homolog (good) or a coincidental match in a different gene family (bad). Check whether the aligned regions correspond to known functional domains.
3. Multiple hits with similar E-values. If your query produces 50 hits with E-values between 1e-20 and 1e-30, your query is likely matching a conserved domain shared across many genes. This is especially common with kinase domains, zinc fingers, and other widespread motifs. You may need to redesign your query for specificity.
4. Gaps in the alignment. Large gaps (insertions or deletions) between query and subject suggest structural differences. Check whether the gaps correspond to known variable regions or whether they indicate a misalignment.
5. Matches to unexpected organisms. If you search a human gene and the top hit is from bacteria, something is wrong. Either your query is contaminated, the database has errors, or the match is a conserved domain (like a ribosomal protein) that exists across all life.
Interpret BLAST Results Instantly
Run BLAST online and get ranked results with E-values, identity, coverage, and pairwise alignments — all in one view. No NCBI account required.
Run Free BLAST Search →Frequently Asked Questions
What is a good E-value in BLAST?
A good E-value depends on your search goal. For species-level identification, aim for E-value 0.0 or below 1e-100. For homology detection, below 1e-10 is considered significant. Between 1e-3 and 1e-10 requires manual inspection. Above 1 is likely noise. Always check E-value alongside percent identity and query coverage — a low E-value with poor coverage may indicate a partial match.
What is percent identity?
Percent identity is the fraction of aligned residues that are identical between your query and the subject sequence. A 100% identity hit means every residue in the alignment matches exactly. For species-level identification, you typically want identity above 95%. For cross-species homology, identity can be 30-70% and still be biologically meaningful, especially when combined with high coverage.
What is query coverage?
Query coverage is the percentage of your query sequence that is included in the alignment. High coverage (above 80%) means most of your query aligns to the subject. A hit with 100% identity but only 20% coverage is likely matching a conserved domain, not the full gene. Always prefer hits with both high identity AND high coverage.
What is an alignment score?
The alignment score (bit score) is a normalised measure of alignment quality. Higher scores mean better alignments. Unlike raw scores, bit scores account for database size and composition, making them comparable across different BLAST runs. Use bit scores to compare hits within the same BLAST result, not across different searches.
How do I know if a BLAST hit is significant?
A significant BLAST hit has a low E-value (below 1e-10), high percent identity (above 30% for protein, above 90% for nucleotide), and high query coverage (above 80%). All three metrics should be evaluated together. A hit with E-value 0.0 but 5% coverage is not a true full-length match. A hit with 100% coverage but E-value 0.5 is likely noise.
Why This Matters for Sequence Analysis
BLAST interpretation is not optional — it is the core skill that determines whether your sequence analysis produces real biological insights or misleading noise. A correctly interpreted BLAST result tells you exactly what your sequence is and where it comes from. An incorrectly interpreted result gives you false confidence in a wrong answer.
After interpreting your BLAST results, you can design primers for confirmed genes using VigyanLLM Primer Design, align homologous sequences with Multiple Sequence Alignment, or verify your findings against published standards at the validation benchmark.
References
- Altschul S.F., et al. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403-410.
- Altschul S.F., et al. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25(17), 3389-3402.
- Schaffer A.A., et al. (2001). Improving the accuracy of PSI-BLAST protein database searches with composition-based statistics and other refinements. Nucleic Acids Research, 29(14), 2994-3005.
- Ye J., et al. (2012). Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics, 13, 134.