Why BLAST Program Selection Matters
BLAST comes in five flavours — blastn, blastp, blastx, tblastn, and tblastx — each designed for a specific type of sequence comparison. Choosing the wrong one does not just give suboptimal results; it gives wrong answers. A protein query run through blastn will miss homologs where the DNA has diverged but the amino acid sequence is conserved. A nucleotide query run through blastp will fail entirely because blastp expects amino acid input.
The core question is simple: what are you comparing, and what do you want to find? If your query is DNA and you want the closest DNA match, use blastn. If your query is protein and you want to find similar proteins, use blastp. If you want to cross the nucleotide-protein boundary — finding protein homologs from a DNA query, or finding genes from a protein query — use the translated programs.
This guide walks through all five programs, explains when each is appropriate, and provides a decision framework you can apply to any search.
All Five BLAST Programs Explained
blastn — Nucleotide vs Nucleotide
blastn compares a nucleotide query against a nucleotide database. It uses a simple match/mismatch scoring system (typically +2 for a match, -3 for a mismatch) and the blastn短字长 (word size 11 or 28 depending on sensitivity). This is the fastest BLAST program because it performs no translation.
Use blastn for: primer specificity checking, identifying a PCR product, verifying a synthetic oligonucleotide, finding a gene in a genome, or comparing two DNA sequences at the nucleotide level.
blastp — Protein vs Protein
blastp compares a protein query against a protein database. It uses substitution matrices like BLOSUM62 or PAM250 that score amino acid substitutions based on how frequently they occur in known evolution. blastp is more sensitive than blastn for detecting distant homologs because protein sequences are more conserved than DNA — two proteins can share 70% amino acid identity while their genes have only 50% nucleotide identity.
Use blastp for: protein function prediction, domain detection, evolutionary analysis, or when your query is an amino acid sequence.
blastx — Translated Nucleotide vs Protein
blastx translates a nucleotide query in all six reading frames and searches a protein database. This is the program to use when you have a DNA sequence but want to find protein homologs. The six-frame translation accounts for all possible open reading frames, so blastx can identify the correct coding frame even if you do not know where the gene starts.
Use blastx for: identifying coding regions in uncharacterised DNA, finding conserved protein domains in newly assembled contigs, or confirming that a nucleotide sequence encodes a known protein.
tblastn — Protein vs Translated Nucleotide
tblastn takes a protein query and searches against a nucleotide database that has been translated in all six reading frames. This is the reverse of blastx — you have a protein and want to find its encoding gene in a genome that only has nucleotide data. tblastn is invaluable for genome annotation and for finding genes in organisms where protein databases are sparse.
Use tblastn for: finding the gene that encodes a known protein in a genome, genome annotation, or searching protein sequences against transcriptome assemblies.
tblastx — Translated Nucleotide vs Translated Nucleotide
tblastx translates both the query and the database in all six reading frames, then compares the resulting protein sequences. This is the most sensitive BLAST program but also the slowest. It is used for comparing two nucleotide sequences at the protein level — useful for finding remote homologs between coding regions that have diverged at the DNA level.
Use tblastx for: comparing coding regions across distant species, finding remote homologs between assembled contigs and known genes, or when blastx fails to find significant hits.
DNA query, want DNA match → blastn. Protein query, want protein match → blastp. DNA query, want protein match → blastx. Protein query, want DNA gene → tblastn. DNA vs DNA at protein level → tblastx. If in doubt, start with blastn or blastp — they are the fastest and cover most use cases.
Decision Guide: Which Program to Use
Use this flowchart to select the right program for your search:
| Your Query | Database Type | Goal | Use This Program |
|---|---|---|---|
| Nucleotide (DNA/RNA) | Nucleotide | Find closest DNA match, verify primer, identify gene | blastn |
| Protein (amino acid) | Protein | Find similar proteins, predict function, detect domains | blastp |
| Nucleotide (DNA/RNA) | Protein | Find protein homologs from a DNA query | blastx |
| Protein (amino acid) | Nucleotide | Find the gene encoding a protein in a genome | tblastn |
| Nucleotide (DNA/RNA) | Nucleotide | Compare coding regions at protein level (remote homologs) | tblastx |
Sensitivity vs Speed Trade-off
Programs that perform translation are slower but more sensitive for cross-type searches. Here is the approximate speed and sensitivity ranking:
- Fastest: blastn (no translation, direct nucleotide comparison)
- Fast: blastp (direct protein comparison using substitution matrices)
- Moderate: blastx, tblastn (one side translated in 6 frames)
- Slowest: tblastx (both sides translated in 6 frames — 36 combinations)
For most routine searches, blastn and blastp are sufficient. Only reach for blastx, tblastn, or tblastx when you specifically need to cross the nucleotide-protein boundary or detect remote homologs.
Worked Example: GAPDH Gene
Query: GTCTCCTCTGACTTCAACAGCG (22 bp, human GAPDH forward primer)
Running blastn against nt: Top hit is Homo sapiens GAPDH mRNA (NM_002046.7) at 100% identity, E-value 0.0, coverage 100%. This confirms the primer targets GAPDH correctly.
Running blastx against nr: The same query is translated in all six frames. The top protein hit is Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (NP_002037.1) at 100% identity. This confirms the primer falls within the GAPDH coding region.
Running blastp: This fails because blastp expects a protein query. The 22-nucleotide sequence is not a valid amino acid input.
Lesson: For a short nucleotide query like a primer, blastn is the right choice. Use blastx only when you want to confirm the query falls within a protein-coding region.
Program Comparison Table
| Program | Query | Database | Scoring | Speed | Best For |
|---|---|---|---|---|---|
| blastn | Nucleotide | Nucleotide | Match/mismatch | Fastest | Primer checking, gene finding, DNA identity |
| blastp | Protein | Protein | BLOSUM62/PAM | Fast | Protein function, domains, evolution |
| blastx | Nucleotide (6-frame) | Protein | BLOSUM62/PAM | Moderate | Coding region identification, protein homologs from DNA |
| tblastn | Protein | Nucleotide (6-frame) | BLOSUM62/PAM | Moderate | Finding genes from protein queries |
| tblastx | Nucleotide (6-frame) | Nucleotide (6-frame) | BLOSUM62/PAM | Slowest | Remote coding-region homologs |
Common Program Selection Mistakes
1. Running a protein query through blastn. blastn expects nucleotide input. If you paste a protein sequence into blastn, the tool interprets it as a nucleotide sequence (A, C, G, T only) and produces garbage results. If your query contains amino acid letters (L, V, I, etc.), use blastp or blastx.
2. Using blastn when you need protein-level comparison. Two genes can encode the same protein but have only 60% nucleotide identity due to codon degeneracy. blastn will miss this relationship. If you suspect your DNA query encodes a conserved protein, use blastx instead.
3. Using blastx for primer verification. blastx translates in all six frames, which is unnecessary for a primer that you know targets a specific strand. blastn is faster and gives you the exact nucleotide match you need for primer checking.
4. Forgetting that tblastx is extremely slow. tblastx translates both query and database in six frames, creating 36 possible comparisons per hit. For large databases, this can take hours. Use tblastx only when blastx fails to find significant hits and you suspect remote homology.
5. Not matching the database to the program. blastx requires a protein database (nr). tblastn requires a nucleotide database. Using the wrong database type produces an error or empty results. Always check that your database matches the program's expected input type.
Choose the Right BLAST Program — Try It Free
Run blastn, blastp, blastx, tblastn, or tblastx on any sequence. No NCBI account. No server queue. Instant results with E-values, identity, and pairwise alignments.
Run Free BLAST Search →Frequently Asked Questions
What is the difference between blastn and blastp?
blastn compares a nucleotide query against a nucleotide database using match/mismatch scoring, while blastp compares a protein query against a protein database using substitution matrices like BLOSUM62. blastp is more sensitive for detecting distant homologs because protein sequences are more conserved across evolution than DNA. Use blastn for DNA identity searches (primer checking, gene finding) and blastp for functional homology detection.
When should I use blastx?
Use blastx when you have a nucleotide sequence but want to find protein homologs. blastx translates your query in all six reading frames and searches a protein database. This is ideal for identifying coding regions in uncharacterised DNA, finding conserved protein domains in newly assembled contigs, or confirming that a nucleotide sequence encodes a known protein.
What is tblastn?
tblastn takes a protein query and searches against a nucleotide database that has been translated in all six reading frames. This is useful when you have a protein sequence and want to find its encoding gene in a genome that only has nucleotide data available. tblastn bridges the protein-to-genome gap without requiring a pre-computed protein database.
Which BLAST program is fastest?
blastn is the fastest BLAST program because it performs a direct nucleotide comparison without any translation step. Among the translated programs, blastx and tblastx are the slowest because they translate sequences in six reading frames. For large-scale searches, blastn on nucleotide databases or blastp on protein databases are the most efficient choices.
Can I compare DNA to protein with BLAST?
Yes. Use blastx to compare a DNA query against a protein database (it translates the DNA in all six frames), or tblastn to compare a protein query against a translated nucleotide database. Both programs handle the nucleotide-to-protein comparison by translating one side in all six reading frames.
Why Program Selection Matters for Sequence Analysis
Choosing the right BLAST program is the single most important decision in any sequence search. The wrong program does not just give suboptimal results — it gives wrong answers. A protein query through blastn misses homologs. A nucleotide query through blastp fails entirely. Match your query type to the right program, and you will get meaningful results every time.
After identifying your sequences with BLAST, you can design primers using VigyanLLM Primer Design, align homologous sequences with Multiple Sequence Alignment, or perform protein docking with Molecular Docking — all free in your browser.
References
- Altschul S.F., et al. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403-410.
- Altschul S.F., et al. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25(17), 3389-3402.
- Camacho C., et al. (2009). BLAST+: architecture and applications. BMC Bioinformatics, 10, 421.
- Mount D.W. (2007). Using the Basic Local Alignment Search Tool (BLAST). CSH Protocols, pdb.prot4713.