Why is my PCR gel empty, and what do I check first?
The empty gel is the single most frustrating PCR failure, and it almost always comes from one of four places: degraded or missing template, primers that never annealed, an inactivated polymerase, or a thermocycler that never reached its targets. Work the checklist in this order — gel, template, primer, master mix, cycler — and change one variable at a time.
Let Me Walk You Through a Diagnosis
My GAPDH control worked fine last week. Today I ran the same reaction and the lane is empty. I’ve done this hundreds of times and almost every time the cause is embarrassingly simple. Here is the exact order I check things — and the order matters, because it moves from fastest to check to slowest to fix.
Step 0 — Look at the whole gel first
Before touching anything, glance at every lane and the ladder. Is the gel itself fine — did the ladder run and the other samples lane up? If the ladder is fine but every sample lane is clean, the problem is in something shared: the master mix, the polymerase, or the cycler. If only one lane is empty, focus on that template or that primer stock. That single observation cuts the problem space in half.
Step 1 — Check the template
Genomic DNA sitting on the bench overnight, or repeat freeze–thaw, degrades faster than most people expect, especially in plain water instead of TE buffer. I nanodrop again: A260/A280 above ~1.8 is my rule of thumb, and if A260/230 is below ~1.5 I suspect salt or leftover ethanol carried over from the kit — both are classic inhibitors. And I always confirm the concentration was right; pipetting 1 µL of a thin stock and getting 5 ng instead of 50 ng explains a lot. If I’m unsure whether it’s the template or the reaction, I run an internal control primer set against the same template — if that amplifies, the template is fine.
Step 2 — Check the primers
Primers sitting in water at 4°C hydrolyse slowly; the freeze–thaw cycle actually damages them faster than many people assume, and they’re fine in TE (10 mM Tris, 0.1 mM EDTA, pH 8) for years. I check the stock tube for visible degradation only when I trust the chemistry — honestly the more reliable check is to run my control primer pair and, if that works, redesign or re-order the failing pair. Annealing same low is the next cause: if my Tm is 58°C but the cycler is at 52, primers can still bind — but a badly mismatched Tm for the target region is a silent failure.
Step 3 — Check the polymerase and master mix
Polymerases are temperature sensitive and the most commonly wasted reagent. If the tube has been on ice at room temperature for hours, or the enzyme has survived many freeze–thaws, I replace it with a fresh tube and re-run. I also check expiry — an inactivated polymerase gives you a perfectly clean empty lane. And while I’m here, I confirm the buffer they came with (or my own 10×) is the right one — using the wrong salt buffer is a quiet, avoidable killer.
Step 4 — Check the thermal cycler
Less sexy, but real: the lid hinge can loosen, and a cycler that sat at the wrong calibration for one block swallows the run. I open the cycler and check the run log or put in a probe. If the reaction is in a strip that never seated, the lid heat never touched it. Most labs keep a backup cycler and a calibration probe for exactly this reason; I use them when the ladder and mixes are all verified and the sample still refuses to amplify.
Step 5 — Change one variable at a time
The worst troubleshooting habit is changing three things at once, because if the tube then works you cannot have any idea which one fixed it — and you haven’t actually diagnosed the lab. I run a small gradient: template amount (keep), MgCl2 (raise a little), cycling Ta (+− 2–3°C), cycles (−4). One changed per well. That is the difference between fixing a reaction and fixing the understanding.
Four Symptoms, Four Decision Trees
Real troubleshooting is symptom-led. Here are the four failures I actually see, arranged by what to check first.
1. No band at all
- Positive control? If that also fails, it’s master mix, polymerase, or cycler — the whole reaction.
- Template degraded or too little — re-prep and nanodrop.
- Primers degraded or Tm too cold.
- Master mix missing a component — Mg²⁺, dNTPs, enzyme.
- Cycler never hit denature (94–98°C) or anneal correctly.
2. Smear or multiple bands
- Annealing too low — raise Ta 2–3°C.
- Too much template or too many cycles.
- Non-specific binding — use hot-start polymerase and a touchdown protocol.
3. Primer dimer but no product
- Primer concentration too high — drop to ~0.2 µM.
- Tm mismatch between the two primers.
- Template quality.
- Mg²⁺ too high — stabilises unspecific binding.
4. Weak band
- Low template input.
- A few too few cycles.
- Inhibitor carried over from prep (salt/ethanol heme in blood).
- Suboptimal Mg²⁺.
What Primer-Dimer Actually Looks Like
It helps to recognise the enemy by sight. A true primer dimer is a tight, bright band around 50–80 bp — so short it can run off a standard gel — and it often stains brighter than your faint 200 bp product, because it’s amplified in enormous molar amounts. In qPCR it shows as a melt pretty sharp at 75–80°C. The stain matters here: ethidium bromide and GelRed are fine for this, but SYBR Safe is noticeably dimmer and can hide a weak product next to a burning dimer band. If you see a strong short band and a weak long one, drop the primer concentration first — I see this fixed by going from 0.4 µM to 0.2 µM more often than by redesign.
The Mg²⁺ Titration Box
Magnesium is the PCR variable people get wrong the most. Too little → no product. Too much → smears and primer dimer, because Mg²⁺ stabilises primer–template and non-specific binding. The standard window is 1.5–2.5 mM, but it is primer-dependent. Tune by +0.5 mM increments:
| Symptom | Mg²⁺ direction |
|---|---|
| No band | try +0.5 mM |
| Smear / multiple bands | try −0.5 mM |
| Primer dimer | try −0.5 mM (and lower primer conc) |
| Weak / inconsistent band | titrate 1.5 / 2.0 / 2.5 mM |
A Worked Scenario: GAPDH Worked Last Week
Let’s run the full diagnostic on the exact case I opened with. GAPDH pair: forward GTCTCCTCTGACTTCAACAGCG, reverse ACCACCCTGTTGCTGTAGCCAA — a validated OriGene pair (TS HP205798) I use as my daily control, 131 bp amplicon, annealing 58°C.
- The gel: every lane clean, ladder perfect. So it’s systemic — not one sample.
- Template: A260/280 = 1.9, A260/230 = 1.2. That 1.2 flags carryover from the extraction — I re-precipitated and re-diluted the DNA, and the amp came back.
- Primers: stock in the fridge for two weeks, not freeze-thawed. Left them as-is — fine.
- Cycler: log showed block reached 94.0°C, anneal 58.0 ± 0.2. Fine.
The killer was the 260/230. A salt- or ethanol-carried template behaves like no template at all. In that order — read the gel, then the template, then the primers, then the machine — I find the fix in minutes instead of chasing ghost controls.
How to Know Your Primers Are Degraded
The dirty truth is that most “degraded primer” diagnoses are wrong — primers in TE at −20°C are remarkably stable. The failure is almost always the annealing design or the Mg²⁺. But when primers genuinely degrade, you’ll see it as a slow slide in yield and specificity across independent runs, not a single sharp failure. The honest check is to run a known-good positive control (like this GAPDH pair) on fresh TE-buffered primers, then re-synthesise the suspect pair and compare. If the control is fine and your assay still fails, it was never the primers’ age — redesign after checking Tm match and 3′ complementarity.
The output of all good troubleshooting is the same: find one cause, fix one thing, and confirm with a positive control. Keep the controls cheap and the single-change discipline even cheaper.
Validate Your Primers Before You Order
Check Tm, GC%, hairpin, and dimer before a single expensive gel.
Try VigyanLLM Primer Free →